rs10218533 chr1:87869791 T>C
- Sequence
cctgagtcatttctgcaatttcct[T/C]attttcccaagccaggaagtttag
- ASB in cell types
- CD14+ monocytes MDM(monocyte derived macrophages) HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- STAT1_HUMAN SPI1_HUMAN TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 2.92 | n/a | 3.00 | n/a | No Hit | |||
| SPI1_HUMAN | 1.45 | 0.59 | 1.58 | 1.55 | Weak Discordant | |||
| TF65_HUMAN | 1.58 | 0.37 | 1.33 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP irritible bowel syndrome, lung function, forced expiratory volume in 1 second (fev1) change in response to inhaled corticosteroids for the treatment of asthma, salmonella-induced pyroptosis