rs10231372 chr7:150435975 T>C
- Sequence
tacttggtacctgaaatgaagaca[T/C]gtgggacaaagccactccagctga
- ASB in cell types
- germinal center B-cells MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| germinal center B-cells | 0.45 | 2.06 | 2.10 | |||
| MS-1 (Small cell lung carcinoma) | 1.95 | -0.01 | 1.00 |
Items per page:
1 – 2 of 2