rs102518 chr11:35163747 A>G
- Sequence
tccccccagctaaatgtgcatggt[A/G]ttagcaaattctaacccaagatgt
- ASB in cell types
- GM19238 (female B-cells lymphoblastoid cell lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19238 (female B-cells lymphoblastoid cell lines) | -0.83 | 1.00 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, college completion, hdl cholesterol, ldl cholesterol, serum creatinine, triglycerides