rs10251845 chr7:928802 C>T
- Sequence
taacagtctggcagttcctcaaaa[C/T]ggtaaacacagagttaccatagag
- ASB in cell types
- CD14+ monocytes MDM(monocyte derived macrophages) monocyte-derived macrophages from peripheral blood monocytes from periferal blood
- ASB for transcription factors
- SPI1_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.53 | 0.17 | 1.61 | 0.44 | Weak Discordant | |||
| STAT1_HUMAN | 3.75 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
