rs10258470 chr7:12291890 A>G
- Sequence
ccccggaggtgcctccagctgggg[A/G]gtcagctaaagcctttaacccaat
- ASB in cell types
- epithelial cell of prostate 2588 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| epithelial cell of prostate | -2.41 | 2.72 | 1.00 | |||
| 2588 (Lymphoblastoid Cell Lines) | 1.29 | -0.94 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Esophagus_Mucosa, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg