rs10258717 chr7:12292025 A>G
- Sequence
ctgagtatggatatattagctcat[A/G]tgggaaccaccatccttatggctc
- ASB in cell types
- MS-1 (Small cell lung carcinoma) LNCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | 0.80 | -0.60 | 1.00 | |||
| LNCaP (prostate carcinoma) | 2.27 | 0.66 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Esophagus_Mucosa, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg