rs10263842 chr7:84243199 C>T
- Sequence
ggaggagttcctctttttctattg[C/T]ttggagtagtttcacaatgaatgg
- ASB in cell types
- monocyte-derived dendritic cells THP-1 (acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocyte-derived dendritic cells | n/a | 2.08 | 2.00 | |||
| THP-1 (acute monocytic leukemia) | 1.70 | -0.56 | 1.14 |
Items per page:
1 – 2 of 2