rs10265151 chr7:22577739 G>C
- Sequence
ctcacacttcacaggatattaatc[G/C]ctcagagctcttgccctccctttc
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells) EOL-1 (Acute myeloid leukemia) JB6 (Human anaplastic large cell lymphoma)
- ASB for transcription factors
- NOTC1_HUMAN GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NOTC1_HUMAN | 2.37 | -4.83 | 2.00 | n/a | n/a | |||
| GCR_HUMAN | 0.88 | 0.27 | 1.30 | n/a | No Hit |
Items per page:
1 – 2 of 2