rs10269993 chr7:132380274 G>T
- Sequence
tgtggaatttgcagcattgtgatc[G/T]tgtgcaaagggcagcaccaggccc
- ASB in cell types
- hMADS-3 (adipose-derived stem cells) MSC (mesenchymal stem cells)
- ASB for transcription factors
- PPARG_HUMAN CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PPARG_HUMAN | 1.74 | 0.01 | 1.80 | 1.48 | Weak Discordant | |||
| CEBPB_HUMAN | -0.15 | 1.99 | 1.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), serum creatinine, years of education