rs10273150 chr7:11557798 G>C
- Sequence
gtgggggtggggagtgctttacca[G/C]atagcaactagcagtgatggaagt
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 2588 (Lymphoblastoid Cell Lines) | -1.19 | 1.67 | 1.00 | |||
| foreskin keratinocyte | 1.14 | -1.06 | 1.67 |
Items per page:
1 – 2 of 2