rs1035625 chr2:170235935 A>G
- Sequence
ctaagatcagcccagggccttttt[A/G]ggacatctgatgtggcagtagggt
- ASB in cell types
- K562 (myelogenous leukemia) GM12890 (Lymphoblastoid Cell Lines) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.89 | 0.60 | 1.06 | |||
| GM12890 (Lymphoblastoid Cell Lines) | -0.96 | 1.00 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.78 | 0.32 | 1.07 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, cystatin c in serum, hdl cholesterol, irritible bowel syndrome, ldl cholesterol change with statins, systolic blood pressure (sbp), total cholesterol change with statins