rs10380 chr5:7897078 C>T
- Sequence
ttatatttcagaaaagagctcaga[C/T]atttccttaagcatgggatcttaa
- ASB in cell types
- GM10847 (female B-cells Lymphoblastoid Cell Lines) GM12890 (Lymphoblastoid Cell Lines) GM12891 (male B- cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM10847 (female B-cells Lymphoblastoid Cell Lines) | -2.52 | 2.62 | 1.00 | |||
| GM12890 (Lymphoblastoid Cell Lines) | -1.93 | 2.46 | 1.00 | |||
| GM12891 (male B- cells lymphoblastoid cell line) | -2.06 | 2.35 | 1.50 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cortex, Brain_Frontal_Cortex_BA9, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood