rs10399672 chr1:247372781 C>T
- Sequence
tgcgctcagcccactatggtcgtt[C/T]ttaaaacaaattgcaaggtcatgc
- ASB in cell types
- LNCaP (prostate carcinoma) MOLM-13(acute monocytic leukemia(AML), Homo sapiens) neutrophils
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | -0.39 | 1.15 | 1.17 | |||
| MOLM-13(acute monocytic leukemia(AML), Homo sapiens) | 2.81 | -5.04 | 2.00 | |||
| neutrophils | 2.37 | 0.03 | 1.50 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP amyotrophic lateral sclerosis (als), asthma, chronic kidney disease, hypertension (early onset hypertension), microalbuminuria, stabilized warfarin dose, urinary albumin-to-creatinine ratio