rs10404066 chr19:11923791 G>C
- Sequence
tttgtctcgcgaaactaatcgatg[G/C]ggtgagaagtagctgaataacctg
- ASB in cell types
- HMEC (human mammary epithelial cells) kidney hepatocytes
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HMEC (human mammary epithelial cells) | 2.04 | -0.55 | 1.00 | |||
| kidney | -1.86 | 2.66 | 2.00 | |||
| hepatocytes | 0.13 | 1.09 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP ldl cholesterol, ldl cholesterol change with statins, total cholesterol, total cholesterol change with statins, triglycerides change with statins
GTEx eQTL Artery_Aorta, Brain_Cerebellar_Hemisphere, Cells_Cultured_fibroblasts, Muscle_Skeletal, Nerve_Tibial, Pituitary, Testis, Thyroid, Whole_Blood