rs10414408 chr19:43207309 G>C
- Sequence
tgggctgtgggttccgctgaggga[G/C]gttggcatcccctaggaaggctcc
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) adrenal gland sigmoid colon ID00014 (lymphoblastoid cell, DiGeorge syndrome)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.67 | -0.03 | 2.96 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Brain_Cerebellar_Hemisphere, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Kidney_Cortex, Minor_Salivary_Gland, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Vagina, Whole_Blood