rs10417167 chr19:48686272 T>C
- Sequence
gtttcagtgtccttggcacagggc[T/C]agtagtcctggagatgatttcatg
- ASB in cell types
- D283 Med (medulloblastoma)
- ASB for transcription factors
- OTX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| OTX2_HUMAN | -3.45 | 2.23 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Amygdala, Brain_Caudate_basal_ganglia, Brain_Cortex, Brain_Putamen_basal_ganglia, Esophagus_Mucosa