rs10419910 chr19:28403718 T>C
- Sequence
ctcgccacttccctgccacgaccc[T/C]gctccaagccaccatcatctctta
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.06 | 1.55 | 2.08 | |||
| HEK293 (embryonic kidney) | 0.22 | 1.02 | 4.43 |
Items per page:
1 – 2 of 2