rs1043096 chr1:111139685 G>C
- Sequence
ctttgcctgggaccaggaaaagac[G/C]cgagagacggaactcggcatcagg
- ASB in cell types
- 22RV1 (prostate carcinoma) HepG2 (hepatoblastoma) GM12892 (female B-cells lymphoblastoid cell line) GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 2.45 | -0.86 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), aortic valve calcium, birth weight, dennd2d gene expression in peripheral blood leucocytes, gamma-glutamyl transferase (ggt), waist hip ratio