rs10431866 chr15:98519453 A>T
- Sequence
aactcaggaacaacttcagtgcag[A/T]gaaataaaaccctgtctttctcaa
- ASB in cell types
- HEK293 (embryonic kidney) sigmoid colon A549 (lung carcinoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.74 | 0.86 | 1.26 | n/a | No Hit |
Items per page:
1 – 1 of 1