rs10443 chr14:68793573 C>T
- Sequence
ttgccagcgggagctgaagcccgt[C/T]cttagcgcccgggccgcggtttcc
- ASB in cell types
- primary B-CLL cells iPS-derived dermal fibroblasts ESO-26 (Gastroesophageal junction adenocarcinoma)
- ASB for transcription factors
- BRD4_HUMAN KLF5_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | 1.23 | 0.43 | 1.50 | n/a | n/a | |||
| KLF5_HUMAN | 2.30 | -1.98 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2