rs10456456 chr6:37683787 G>A
- Sequence
tggcttcctttgcttccctgtctc[G/A]cttccccattcctctaccagagtt
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia) GM12878 (female B-cells lymphoblastoid cell line) SEM (childhood B acute lymphoblastic leukemia) MDM(monocyte derived macrophages)
- ASB for transcription factors
- SPI1_HUMAN IKZF1_HUMAN IKZF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | -0.27 | 2.52 | 1.66 | 4.26 | Concordant | |||
| IKZF1_HUMAN | -2.75 | 2.52 | 1.25 | n/a | No Hit | |||
| IKZF2_HUMAN | -2.00 | 2.31 | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid, Whole_Blood