rs10468780 chr18:8547216 G>A
- Sequence
agagacagaggggggcaacagaag[G/A]caatataagactttggattgaatc
- ASB in cell types
- GM19238 (female B-cells lymphoblastoid cell lines) MS-1 (Small cell lung carcinoma)
- ASB for transcription factors
- STAG1_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | -1.49 | 1.78 | 1.37 | n/a | n/a | |||
| CTCF_HUMAN | -0.26 | 1.52 | 1.38 | -2.25 | Discordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP asthma, infant head circumference, maternal transmission distortion, urinary albumin-to-creatinine ratio, years of education