rs1046958 chr16:79598568 G>A
- Sequence
aacagccaccaccaccacaaactc[G/A]agcagggtgtggggtgtgtgtgtg
- ASB in cell types
- HEK293 (embryonic kidney) macrophages
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.37 | 0.83 | 1.61 | |||
| macrophages | 1.57 | -0.47 | 2.00 |
Items per page:
1 – 2 of 2