rs10484654 chr6:54017939 G>T
- Sequence
aggattgactgcaatcgtttgaaa[G/T]gacagagctccacaacacattttc
- ASB in cell types
- neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural cell | -1.98 | 1.97 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP barnes akathisia rating scale, comorbid depressive syndrome and alcohol dependence, hdl cholesterol, tardive dyskinesia, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Esophagus_Mucosa, Heart_Left_Ventricle, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid