rs10492790 chr16:23065089 C>T
- Sequence
gtagggctgtcttaaggaatgata[C/T]ggcctcagtgcaatggatgtttac
- ASB in cell types
- MOLM14 (Adult acute myeloid leukemia) MV-4-11 (Childhood acute monocytic leukemia)
- ASB for transcription factors
- CDK8_HUMAN BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CDK8_HUMAN | 0.21 | 1.51 | 1.00 | n/a | n/a | |||
| BRD4_HUMAN | -0.07 | 1.28 | 1.25 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Frontal_Cortex_BA9, Colon_Transverse, Esophagus_Muscularis, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Testis