rs10501021 chr11:25733981 A>G
- Sequence
cctctggagtttaaagtggtattt[A/G]taggcaattttcaaatccaatgtt
- ASB in cell types
- HeLa S3 (cervical adenocarcinoma) HeLa (cervical adenocarcinoma) EOL-1 (Acute myeloid leukemia) GM02610 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.97 | 1.43 | 1.33 | n/a | No Hit | |||
| STAG1_HUMAN | -2.02 | 2.17 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP ct hepatic steatosis, nonalcoholic fatty liver disease, prop taste detection threshold, prostate cancer, triglycerides change with statins