rs10516 chr12:51352050 C>T
- Sequence
ctctcagggatgtaggcggcctcc[C/T]gcagggttgagttgcaatgggaac
- ASB in cell types
- K562 (myelogenous leukemia) MS-1 (Small cell lung carcinoma) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.00 | 0.78 | 2.00 | |||
| MS-1 (Small cell lung carcinoma) | -0.69 | 0.64 | 1.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.89 | 0.07 | 1.48 |
Items per page:
1 – 3 of 3