rs1059369 chr19:18386331 T>A
- Sequence
ttcccgggaccctcagagttgcac[T/A]ccgaagactccagattccgagagt
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) K562 (myelogenous leukemia) GM18486 (Lymphoblastoid Cell Lines) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12891 (male B- cells lymphoblastoid cell line) | n/a | 4.40 | 1.33 | |||
| K562 (myelogenous leukemia) | 0.79 | 0.26 | 2.00 | |||
| GM18486 (Lymphoblastoid Cell Lines) | -1.47 | 1.60 | 1.00 | |||
| HepG2 (hepatoblastoma) | 0.70 | 0.89 | 1.10 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 1.40 | 0.65 | 1.13 |
Items per page:
1 – 5 of 6