rs10740354 chr10:70559266 C>T
- Sequence
catccgggggaagaatggttcaga[C/T]agagggtgtggcttgcgtgcagtc
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- NRF1_HUMAN ETV1_HUMAN REQU_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NRF1_HUMAN | 2.51 | -0.25 | 1.00 | n/a | No Hit | |||
| ETV1_HUMAN | 2.63 | -2.29 | 1.00 | n/a | No Hit | |||
| REQU_HUMAN | 2.04 | -0.34 | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), fluid intelligence (combination of multiple tests), hypertension (early onset hypertension), partial epilepsy, serum creatinine, systolic blood pressure (sbp)