rs10753268 chr1:32873002 G>T
- Sequence
ggggtgcttgggccttaattctgg[G/T]gaaagccctggtgcctggaatctg
- ASB in cell types
- HEK293 (embryonic kidney) ID00014 (lymphoblastoid cell, DiGeorge syndrome) RWPE2
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.03 | 0.57 | 1.98 | |||
| ID00014 (lymphoblastoid cell, DiGeorge syndrome) | -1.06 | 1.64 | 1.00 | |||
| RWPE2 | -1.44 | 1.74 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood