rs10761690 chr10:63073303 T>C
- Sequence
tgatgtgggaccaaaggtctagac[T/C]agacatgggctcttccactccaaa
- ASB for transcription factors
- TEAD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TEAD4_HUMAN | -2.40 | 2.75 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, body mass index (bmi), college completion, fasting insulin, hdl cholesterol, height, homa-ir, total cholesterol change with statins, triglycerides, triglycerides change with statins, waist hip ratio, years of education