rs1076726 chr1:15152787 G>A
- Sequence
aggggcggaggcagagccgcgggt[G/A]agaggcttccgcgccgacttcggg
- ASB in cell types
- HEK293 (embryonic kidney) GM02255 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.83 | 0.16 | 1.97 | |||
| GM02255 (Lymphoblastoid Cell Lines) | 2.25 | -0.69 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, homa-ir, rheumatoid arthritis, serum creatinine, systolic blood pressure (sbp)
GTEx eQTL Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Brain_Amygdala, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Esophagus_Mucosa, Esophagus_Muscularis, Minor_Salivary_Gland, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid