rs10767439 chr11:25734803 A>G
- Sequence
atgcactgttatggcgccctctat[A/G]ggcaacccagctcttctaatttaa
- ASB in cell types
- foreskin keratinocyte adrenal gland
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.82 | n/a | 2.33 | |||
| adrenal gland | -2.01 | 2.20 | 1.00 |
Items per page:
1 – 2 of 2