rs10773959 chr12:1541022 A>G
- Sequence
gagagagactttgaaattatagaa[A/G]cttgtctggtgagatgaaatagta
- ASB in cell types
- HCASMC (Human coronary artery smooth muscle cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HCASMC (Human coronary artery smooth muscle cells) | 1.78 | -0.76 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), cystatin c in serum, irritible bowel syndrome, triglycerides