rs10817691 chr9:114957982 A>C
- Sequence
taaaatctggacaggagggtagga[A/C]ctggtaccttgggccaggcagctt
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.37 | n/a | 3.00 | -4.05 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP birth weight, lung function, predicted ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc)