rs10819168 chr9:126483032 G>A
- Sequence
ctggcctcacaggaaacccctgct[G/A]gcttcgcggaggctccagctcccc
- ASB in cell types
- bipolar neuron neural progenitors
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.31 | 0.75 | 1.12 | -4.05 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Nerve_Tibial, Prostate, Skin_Sun_Exposed_Lower_leg, Spleen, Whole_Blood