rs10820748 chr9:104926484 C>A
- Sequence
accaaaaaaacaaaaaaaaaaaaa[C/A]aaaacgggctttcgcctcaacctc
- ASB in cell types
- glioblastoma cells MCF7L-P(immortalized breast epithelial cell line) neural progenitors
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| glioblastoma cells | 2.76 | -4.23 | 1.33 | |||
| MCF7L-P(immortalized breast epithelial cell line) | 2.93 | -5.44 | 2.00 | |||
| neural progenitors | 2.24 | -2.06 | 1.00 |
Items per page:
1 – 3 of 3