rs10824026 chr10:73661450 G>A
- Sequence
ggaaatgcaaagtgtttctgttgc[G/A]aaatacttcacctagggtgactat
- ASB in cell types
- K562 (myelogenous leukemia) BEAS-2B (bronchial epithelium)
- ASB for transcription factors
- ATF3_HUMAN GCR_HUMAN ARI1B_HUMAN REQU_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ATF3_HUMAN | 3.51 | -3.50 | 1.00 | n/a | No Hit | |||
| GCR_HUMAN | 2.58 | -1.46 | 1.00 | n/a | No Hit | |||
| ARI1B_HUMAN | 2.23 | -1.95 | 1.00 | n/a | n/a | |||
| REQU_HUMAN | 2.11 | -1.23 | 1.00 | n/a | n/a | |||
| IRF9_HUMAN | 2.74 | -2.62 | 1.00 | n/a | No Hit |
Items per page:
1 – 5 of 7
Motif analysis
No data available
Genetic associations
GRASP asthma, atrial fibrillation, diastolic blood pressure (dbp), methamphetamine-induced psychosis, systolic blood pressure (sbp)
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellum, Brain_Cortex, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood