rs10838259 chr11:44306877 T>C
- Sequence
tctccatcttagacctaacgcgcc[T/C]aatccctttcctagaaggaccaga
- ASB in cell types
- GM23248
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM23248 | n/a | 2.30 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Thyroid