rs10838451 chr11:45333110 C>T
- Sequence
gggtttatgtaccggggaaacatc[C/T]tcgacttgatgttaggagctttga
- ASB in cell types
- 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 2.00 | -1.26 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1