rs10843919 chr12:31238979 T>C
- Sequence
agtcatagtcaccctcagacccca[T/C]ctagcggctgcccgaattatttca
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) THP-1 (acute monocytic leukemia) MCF7 (Invasive ductal breast carcinoma) IMR-5 (Neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02610 (Lymphoblastoid Cell Lines) | n/a | 2.38 | 1.33 | |||
| THP-1 (acute monocytic leukemia) | 0.12 | 1.66 | 2.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | 1.81 | 0.77 | 1.77 | |||
| IMR-5 (Neuroblastoma) | 2.03 | -3.17 | 1.50 | |||
| T-ALL cells from peripheral blood | 1.90 | -1.45 | 1.00 |
Items per page:
1 – 5 of 9