rs10845939 chr12:7807020 A>G
- Sequence
ctctttgggcaaagccattaagtc[A/G]atgttaagctcactgagagagtca
- ASB in cell types
- glioblastoma cells thyroid gland right lobe of liver testis
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| glioblastoma cells | 1.00 | n/a | 1.50 | |||
| thyroid gland | -1.35 | 1.52 | 1.17 | |||
| right lobe of liver | -1.55 | 1.83 | 1.00 | |||
| testis | 2.05 | -1.73 | 1.00 | |||
| CD34+ hematopoietic stem cells | 2.48 | n/a | 2.00 |
Items per page:
1 – 5 of 6