rs10846377 chr12:8037284 G>T
- Sequence
ggatgggtcaaaggagaacggtgc[G/T]gaaagatcaaaagaatcagatgct
- ASB in cell types
- hematopoietic stem cells and progenitors NALM-6 (adult B acute lymphoblastic leukemia) MDM(monocyte derived macrophages)
- ASB for transcription factors
- TF7L2_HUMAN FOXK2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF7L2_HUMAN | 2.82 | n/a | 1.00 | n/a | No Hit | |||
| FOXK2_HUMAN | 2.54 | -2.58 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2