rs10851011 chr12:118686062 G>A
- Sequence
ttccccctgactatccctttattg[G/A]tcaacactttttgcctgctgagtc
- ASB in cell types
- sigmoid colon
- ASB for transcription factors
- EP300_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EP300_HUMAN | 2.46 | -2.49 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP ldl cholesterol change with statins, obesity with early age of onset (age >2), parkinsons disease, sporadic creutzfeldt-jakob disease, variant creutzfeldt-jakob disease