rs10851989 chr15:36359414 A>C
- Sequence
tttttgatcagtgatgcccctggc[A/C]catttcaccacgagcaaaatcagc
- ASB in cell types
- SK-UT-1 (Uterine corpus leiomyosarcoma)
- ASB for transcription factors
- HDAC4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HDAC4_HUMAN | -2.06 | 2.84 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), birth weight, chronic kidney disease