rs10861369 chr12:105276559 C>T
- Sequence
atggcaacttccctccctcaggtt[C/T]cttctacccaggcacctccctccc
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia) monocytes from periferal blood
- ASB for transcription factors
- SPI1_HUMAN SRBP2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.26 | 0.82 | 1.43 | n/a | No Hit | |||
| SRBP2_HUMAN | 2.21 | -1.25 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP eye color, homa-b, hypertension (early onset hypertension), ldl cholesterol change with statins, premature ovarian failure, primary rhegmatogenous retinal detachment, schizophrenia, tardive dyskinesia, total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis