rs10861724 chr12:107329940 G>A
- Sequence
tggtgacatgtgcaacaaaggaga[G/A]acatacaggctattagagtcttta
- ASB in cell types
- monocyte-derived dendritic cells MDM(monocyte derived macrophages)
- ASB for transcription factors
- SPI1_HUMAN ETS1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.08 | 0.55 | 1.18 | n/a | No Hit | |||
| ETS1_HUMAN | -1.85 | 2.15 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, aortic valve calcium, bipolar disorder, combined control dataset, gender differentiated, partial epilepsy, paternal transmission distortion, transmission distortion