rs10863912 chr1:211514344 G>A
- Sequence
cgcctgcatgcctcatttacccta[G/A]agagaacaggaaaacctaaacttg
- ASB in cell types
- HEK293 (embryonic kidney) SK-N-SH (neuroblastoma) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.07 | 0.91 | 1.99 | |||
| SK-N-SH (neuroblastoma) | 1.38 | -1.38 | 1.00 | |||
| K562 (myelogenous leukemia) | 0.80 | 0.47 | 2.94 |
Items per page:
1 – 3 of 3