rs10871290 chr16:74438798 C>T
- Sequence
tgctcatcaggcgatctgatactc[C/T]acatcgagaagctccaacctcagg
- ASB for transcription factors
- SPI1_HUMAN SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.57 | -0.02 | 1.00 | n/a | No Hit | |||
| SMCA4_HUMAN | 0.42 | 1.37 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, body mass index (bmi), breast cancer early age of onset, eye color, parkinsons disease, simpson-angus scale, waist hip ratio in controls
PheWAS acute pancreatitis, acute prostatitis, age-related macular degeneration, allergic conjunctivitis, anterior pituitary disorders, arterial embolism and thrombosis, atherosclerosis, atherosclerosis of native arteries of the extremities with intermittent claudication, atherosclerosis of native arteries of the extremities with ulceration or gangrene, atherosclerosis of renal artery, atherosclerosis of the extremities, attention deficit hyperactivity disorder, benign neoplasm of colon, benign neoplasm of respiratory and intrathoracic organs, cellulitis and abscess of arm, cholangitis, chronic airway obstruction, colles fracture, diseases of pancreas, diseases of the tongue, disorders of lipoid metabolism, disorders of sacrum, disorders of the autonomic nervous system, disorders of vitreous body, elevated levels of transaminase or lactic acid dehydrogenase, epilepsy, essential hypertension, fracture of radius and ulna, hemorrhage or hematoma complicating a procedure, herpes zoster, hyperlipidemia, hypertension, hypertensive heart disease, intracranial hemorrhage (injury), jaw disease nos, keloid scar, localized adiposity, macular degeneration, wet, malignant neoplasm of ovary, menieres disease, neoplasm of uncertain behavior, nonrheumatic aortic valve disorders, open wound of ear, oral aphthae, other cells and casts in urine, other dyschromia, other endocrine disorders, other hypertensive complications, other specified diseases of the salivary glands, pancreatic cancer, pathologic fracture, pathologic fracture of vertebrae, pathological, developmental or recurrent dislocation, peripheral vascular disease, pervasive developmental disorders, phosphorus metabolism disorder, renal colic, secondary malignancy of brain/spine, subdural hemorrhage (injury), symptoms involving female genital tract, testicular dysfunction, testicular hypofunction, uterine cancer, vascular dementia, vascular disorders of kidney/hypertrophy, viral warts & hpv
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood