rs10876378 chr12:52873818 A>G
- Sequence
attttctgactgtattgtccctag[A/G]acaatttctgaagcagatgacagc
- ASB in cell types
- K562 (myelogenous leukemia) MCF10A (breast epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.10 | 0.77 | 2.00 | |||
| MCF10A (breast epithelial cells) | -1.11 | 2.06 | 1.00 |
Items per page:
1 – 2 of 2